Prev. | 

RIKEN DNA Bank Human Resource - PXDC1

Gene ID NCBI Gene 221749 |  KEGG hsa:221749
Gene Symbol PXDC1
Protein Name PX domain containing 1
Synonyms C6orf145
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036087 IRAK090D15 pBluescript BC045715 NM_183373 Partial/var
HGX047908 IRAK119M20 pCMV-SPORT6 BC056908 NM_183373

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080840 M01C002B16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE080888 M01C002D16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE080936 M01C002F16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE080984 M01C002H16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE081032 M01C002J16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE081080 M01C002L16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE081128 M01C002N16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE081176 M01C002P16 pDONR221 04-134-2_1-H08 BC056908 ENST00000380283  
HGE095631 M01C039B07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095679 M01C039D07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095727 M01C039F07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095775 M01C039H07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095823 M01C039J07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095871 M01C039L07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095919 M01C039N07 pDONR221 MGC09-C04 BC056908 ENST00000380283  
HGE095967 M01C039P07 pDONR221 MGC09-C04 BC056908 ENST00000380283  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057280 ARe43D08 pKA1U5 NM_183373.3  
GACTCGCCGCCGCGCCGCCCCGCTGCCCCGAACGCGNGCCATACGCAGCCTCCTTGGAGT
HKR205467 ARiS013L03 pGCAP10 NM_183373.3  
GACTCNNNCCGGCTCCCGGCTCCGGGGGTTCTCGTGGCCGCGGCAGCGCGGTCTCTGCGG
HKR209206 ARiS023A06 pGCAP10 NM_183373.3  
GGGGGGTTCTCGTGGCCGCGGCAGCGCGGTCTCTGCGGAGGCGGCGGGGGCGCGGCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl