Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05438

HP ID(1) HP05438
Gene ID(2) 8794
Gene Symbol finder TNFRSF10C
Protein Name tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain
RefSeq NM_003841.2
Length of RefSeq (bp) 1404
Chromosome 8p22-p21
Reference DDBJ accession
UniGene Hs.655801

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43C04 pKA1U5 GAGTCCTGGAGAGGCCTGGGCCTGAACAACATGNCTTTCCCCCAGCGNTGAGACTCGCTT
ARi29F02 pGCAP10 GACACAGTCCTGGAGAGGCCTGAGCCTGAACAACATGGCTTCCCCCAGCGTGAGACTCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl