Prev. |  KEGG KO K04722 > 

RIKEN DNA Bank Human Resource - TNFRSF10C

Gene ID NCBI Gene 8794 |  KEGG hsa:8794
Gene Symbol TNFRSF10C
Protein Name TNF receptor superfamily member 10c
Synonyms CD263|DCR1|DCR1-TNFR|LIT|TRAIL-R3|TRAILR3|TRID
Featured content Apoptosis - human
Ortholog resource in our bank

  TNFRSF10C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07375 pGL4-phTNFRSF10C(MGC31957) Promoter collection, Human TNFRSF10C promoter

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057252 ARe43C04 pKA1U5 NM_003841.2  
GAGTCCTGGAGAGGCCTGGGCCTGAACAACATGNCTTTCCCCCAGCGNTGAGACTCGCTT
HKR171722 ARi29F02 pGCAP10 NM_003841.2  
GACACAGTCCTGGAGAGGCCTGAGCCTGAACAACATGGCTTCCCCCAGCGTGAGACTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl