Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05431

HP ID(1) HP05431
Gene ID(2) 9240
Gene Symbol finder PNMA1
Protein Name paraneoplastic antigen MA1
RefSeq NM_006029.4
Length of RefSeq (bp) 2666
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.194709

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42B08 pKA1U5 ATCCTGACTGCAGCAGTAACGTCGCGGCGGGTTGCGGGATAGGACTGGACGCCAGGGCAG
ARe92F08 pKA1U5 AGTAACGTCGCGGCGGGTTGCGGGTAGGACTGGACGCCAGGGCAGCCGCGCAGCGCCTGA
RBdS081B24 pGCAP10 TGAGGACTGGACGCCAGGGCAGCCGCGCAGCGCCTGAACCGCTGCGGGCCGCCGCGGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl