Prev. | 

RIKEN DNA Bank Human Resource - PNMA1

Gene ID NCBI Gene 9240 |  KEGG hsa:9240
Gene Symbol PNMA1
Protein Name PNMA family member 1
Synonyms MA1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033626 IRAK084B02 pCMV-SPORT6 BC039577 NM_006029 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056832 ARe42B08 pKA1U5 NM_006029.4  
ATCCTGACTGCAGCAGTAACGTCGCGGCGGGTTGCGGGATAGGACTGGACGCCAGGGCAG
HKR076928 ARe92F08 pKA1U5 NM_006029.4  
AGTAACGTCGCGGCGGGTTGCGGGTAGGACTGGACGCCAGGGCAGCCGCGCAGCGCCTGA
HKR432448 RBdS081B24 pGCAP10 NM_006029.4  
TGAGGACTGGACGCCAGGGCAGCCGCGCAGCGCCTGAACCGCTGCGGGCCGCCGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl