Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05418

HP ID(1) HP05418
Gene ID(2) 29982
Gene Symbol finder NRBF2
Protein Name nuclear receptor binding factor-2
RefSeq NM_030759.3
Length of RefSeq (bp) 1916
Chromosome 10q21.2
Reference DDBJ accession
UniGene Hs.449628

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe41B06 pKA1U5 GAGGAAGTGGTGAGGTTGTTGCTCCTTCAGCGCCTATCGCTGGCTCTTGGGGCGCAGAGA
ARi35C06 pGCAP10 GCCTTCAGCGCCTATCGCTGGCTCTTGGGGCGCAGAGAGGGGCCGCAGTCTCCGCGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl