Prev. |  KEGG KO K21246 > 

RIKEN DNA Bank Human Resource - NRBF2

Gene ID NCBI Gene 29982 |  KEGG hsa:29982
Gene Symbol NRBF2
Protein Name nuclear receptor binding factor 2
Synonyms COPR|COPR1|COPR2|NRBF-2
Ortholog resource in our bank

  NRBF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090977 IRAL027H09 pOTB7 BC011707 NM_030759 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000834 W01A002B10 pENTR-TOPO IRAL027H09 BC011707 NM_030759  
HGE000836 W01A002B12 pENTR-TOPO IRAL027H09 BC011707 NM_030759  
HGE000840 W01A002B16 pENTR-TOPO IRAL027H09 BC011707 NM_030759  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056430 ARe41B06 pKA1U5 NM_030759.3  
GAGGAAGTGGTGAGGTTGTTGCTCCTTCAGCGCCTATCGCTGGCTCTTGGGGCGCAGAGA
HKR174054 ARi35C06 pGCAP10 NM_030759.3  
GCCTTCAGCGCCTATCGCTGGCTCTTGGGGCGCAGAGAGGGGCCGCAGTCTCCGCGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl