Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05416

HP ID(1) HP05416
Gene ID(2) 256472
Gene Symbol finder TMEM151A
Protein Name transmembrane protein 151A
RefSeq NM_153266.3
Length of RefSeq (bp) 2546
Chromosome 11q13.2
Reference DDBJ accession
UniGene Hs.399779

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe40H11 pKA1U5 GGCCGCCGCCGCATGCCGCCGCGCTCGGGCTCGACCTCCGCGCACATCCCTCCGCAGGCC
ARe53E09 pKA1U5 GGCACTCCCTCCGCGGCCGCTGAGCCGAGCGGACGCCCCCGGGGGCCGCGTCGCAGCCCT
ARiS109F10 pGCAP10 GGCCGCCGCCGCTGCCGCCGCGCTCGGGCTCGAGCTCCGCGCACTCCCTCCGCGGCCGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl