Prev. | 

RIKEN DNA Bank Human Resource - TMEM151A

Gene ID NCBI Gene 256472 |  KEGG hsa:256472
Gene Symbol TMEM151A
Protein Name transmembrane protein 151A
Synonyms TMEM151
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018480 IRAK046D08 pBluescriptR BC033898 NM_153266

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089629 M01C024B05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089677 M01C024D05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089725 M01C024F05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089773 M01C024H05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089821 M01C024J05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089869 M01C024L05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089917 M01C024N05 pDONR221 MGC01-G03 BC033898 NM_153266  
HGE089965 M01C024P05 pDONR221 MGC01-G03 BC033898 NM_153266  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056179 ARe40H11 pKA1U5 NM_153266.3  
GGCCGCCGCCGCATGCCGCCGCGCTCGGGCTCGACCTCCGCGCACATCCCTCCGCAGGCC
HKR061305 ARe53E09 pKA1U5 NM_153266.3  
GGCACTCCCTCCGCGGCCGCTGAGCCGAGCGGACGCCCCCGGGGGCCGCGTCGCAGCCCT
HKR243730 ARiS109F10 pGCAP10 NM_153266.3  
GGCCGCCGCCGCTGCCGCCGCGCTCGGGCTCGAGCTCCGCGCACTCCCTCCGCGGCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl