Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05409

HP ID(1) HP05409
Gene ID(2) 10791
Gene Symbol finder VAMP5
Protein Name vesicle-associated membrane protein 5 (myobrevin)
RefSeq NM_006634.2
Length of RefSeq (bp) 694
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.534373

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe40C06 pKA1U5 GGGGGCCGCTGGCACTGCGGCCGCTCCGCAGGCAGAGAAGCCGGGAGCGGGCGAGGCGGC
ARe47H03 pKA1U5 GGAGAAGCCGGGAGCGGGCGAGGCGGCGGCGGCAGNAGCGATGGCAGGAATAGAGTTGGA
ARe87F09 pKA1U5 GGCGGCCGCTCCGCAGGCAGAGAAGCCGGGAGCGGGCGAGGCGGCGGCGGCAGCAGCGAT
ARi53H09 pGCAP10 AGAGAAGCCGGGAGCGGGCGAGGCGGCGGCGGCAGCAGCGATGGCAGGAATAGAGTTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl