Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05395

HP ID(1) HP05395
Gene ID(2) 56888
Gene Symbol finder KCMF1
Protein Name potassium channel modulatory factor 1
RefSeq NM_020122.4
Length of RefSeq (bp) 7555
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.654968

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe58G07 pKA1U5 GCTCCCTACGCGCGGCGCGGCGGCGGCGGCGGCTNNCAGGCCGAGGCTGGGCACGGGCGC
ARi15A09 pGCAP10 GCGGGAGCGCTCCCCTGCCCACCCCGCCCCCGCGGCCGAGCCCGGGAGTCGAGTGGGAGT
RBb21E03 pKA1U5 GGCGGGCAGCGCCGGGTACCCCGCGGGGGACACTGCAGCCGGAGCCCGGGAGGGGCCGCG
RBb63F03 pGCAP1 GAGCCGGCAGGCCCGAGAGTGACCGGAGTCACGGCGGGCGCCGGCGGAGCTGCGGCGTCG
RBd01E06 pGCAP10 GAGGCCCGAGAGTGACCGGAGTCACGGCGGGCGCCGGCGGAGCTGCGGCGTCGGACCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl