Prev. | 

RIKEN DNA Bank Human Resource - KCMF1

Gene ID NCBI Gene 56888 |  KEGG hsa:56888
Gene Symbol KCMF1
Protein Name potassium channel modulatory factor 1
Synonyms DEBT91|FIGC|PCMF|ZZZ1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001573 IRAK003P13 pCMV-SPORT6 BC000178 NM_020122 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022159 W01A055G15 pENTR-TOPO IRAK003P13 BC000178 NM_020122  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063351 ARe58G07 pKA1U5 NM_020122.4  
GCTCCCTACGCGCGGCGCGGCGGCGGCGGCGGCTNNCAGGCCGAGGCTGGGCACGGGCGC
HKR166009 ARi15A09 pGCAP10 NM_020122.4  
GCGGGAGCGCTCCCCTGCCCACCCCGCCCCCGCGGCCGAGCCCGGGAGTCGAGTGGGAGT
HKR328499 RBb21E03 pKA1U5 NM_020122.4  
GGCGGGCAGCGCCGGGTACCCCGCGGGGGACACTGCAGCCGGAGCCCGGGAGGGGCCGCG
HKR345323 RBb63F03 pGCAP1 NM_020122.4  
GAGCCGGCAGGCCCGAGAGTGACCGGAGTCACGGCGGGCGCCGGCGGAGCTGCGGCGTCG
HKR360502 RBd01E06 pGCAP10 NM_020122.4  
GAGGCCCGAGAGTGACCGGAGTCACGGCGGGCGCCGGCGGAGCTGCGGCGTCGGACCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl