Prev. | 

RIKEN DNA Bank Human Resource - KCMF1

Gene ID NCBI Gene 56888 |  KEGG hsa:56888
Gene Symbol KCMF1
Protein Name potassium channel modulatory factor 1
Synonyms DEBT91|FIGC|PCMF|ZZZ1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001573 IRAK003P13 pCMV-SPORT6 BC000178 NM_020122 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022159 W01A055G15 pENTR-TOPO IRAK003P13 BC000178 NM_020122  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063351 ARe58G07 pKA1U5 NM_020122.4  
GCTCCCTACGCGCGGCGCGGCGGCGGCGGCGGCTNNCAGGCCGAGGCTGGGCACGGGCGC
HKR166009 ARi15A09 pGCAP10 NM_020122.4  
GCGGGAGCGCTCCCCTGCCCACCCCGCCCCCGCGGCCGAGCCCGGGAGTCGAGTGGGAGT
HKR328499 RBb21E03 pKA1U5 NM_020122.4  
GGCGGGCAGCGCCGGGTACCCCGCGGGGGACACTGCAGCCGGAGCCCGGGAGGGGCCGCG
HKR345323 RBb63F03 pGCAP1 NM_020122.4  
GAGCCGGCAGGCCCGAGAGTGACCGGAGTCACGGCGGGCGCCGGCGGAGCTGCGGCGTCG
HKR360502 RBd01E06 pGCAP10 NM_020122.4  
GAGGCCCGAGAGTGACCGGAGTCACGGCGGGCGCCGGCGGAGCTGCGGCGTCGGACCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl