Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05390

HP ID(1) HP05390
Gene ID(2) 4691
Gene Symbol finder NCL
Protein Name nucleolin
RefSeq NM_005381.2
Length of RefSeq (bp) 2732
Chromosome 2q12-qter
Reference DDBJ accession
UniGene Hs.79110

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118H21 pGCAP10 GAGTCTCNNNNTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGG
RBb20H05 pKA1U5 GGTGCTCCGGGATCTTCAGCACCCGCGGCCGCCATCNCCGTCGCTTGGCTTCTTCTGGAC
RBb71D12 pGCAP1 TGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTCGCGGGAAGC
RBd18C03 pGCAP10 GAGTCTCGAGCTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGG
RBdS013D24 pGCAP10 GAGTCTCGAGCTCNNNTCNGCCTTCGGGTGTACNTGCTCCGGGATCTTCANCACCCGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl