Prev. |  KEGG KO K11294 > 

RIKEN DNA Bank Human Resource - NCL

Gene ID NCBI Gene 4691 |  KEGG hsa:4691
Gene Symbol NCL
Protein Name nucleolin
Synonyms C23|Nsr1
Ortholog resource in our bank

  NCL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080659 IRAL001K19 pOTB7 BC002343 NM_005381 Full/var
HGY080826 IRAL002B02 pOTB7 BC006494 NM_005381 Full/var
HGY084259 IRAL010K19 pOTB7 BC006516 NM_005381 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098017 M01C045A17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098065 M01C045C17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098113 M01C045E17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098161 M01C045G17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098209 M01C045I17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098257 M01C045K17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098305 M01C045M17 pDONR221 MGC12-A09 BC006494 ENST00000322732  
HGE098353 M01C045O17 pDONR221 MGC12-A09 BC006494 ENST00000322732  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247389 ARiS118H21 pGCAP10 NM_005381.2  
GAGTCTCNNNNTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGG
HKR328173 RBb20H05 pKA1U5 NM_005381.2  
GGTGCTCCGGGATCTTCAGCACCCGCGGCCGCCATCNCCGTCGCTTGGCTTCTTCTGGAC
HKR348484 RBb71D12 pGCAP1 NM_005381.2  
TGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTCGCGGGAAGC
HKR367251 RBd18C03 pGCAP10 NM_005381.2  
GAGTCTCGAGCTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGG
HKR405296 RBdS013D24 pGCAP10 NM_005381.2  
GAGTCTCGAGCTCNNNTCNGCCTTCGGGTGTACNTGCTCCGGGATCTTCANCACCCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl