Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCL

Gene ID (NCBI) 4691
Gene Symbol NCL
Protein Name nucleolin
Synonyms C23
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080659 IRAL001K19 pOTB7 BC002343 NM_005381 Full/var
HGY080826 IRAL002B02 pOTB7 BC006494 NM_005381 Full/var
HGY084259 IRAL010K19 pOTB7 BC006516 NM_005381 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE098017 M01C045A17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098065 M01C045C17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098113 M01C045E17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098161 M01C045G17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098209 M01C045I17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098257 M01C045K17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098305 M01C045M17 pDONR221 MGC12-A09 BC006494 ENST00000322732
HGE098353 M01C045O17 pDONR221 MGC12-A09 BC006494 ENST00000322732

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR247389 ARiS118H21 pGCAP10 NM_005381.2
GAGTCTCNNNNTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGG
HKR367251 RBd18C03 pGCAP10 NM_005381.2
GAGTCTCGAGCTCTCGCTGGCCTTCGGGTGTACGTGCTCCGGGATCTTCAGCACCCGCGG
HKR328173 RBb20H05 pKA1U5 NM_005381.2
GGTGCTCCGGGATCTTCAGCACCCGCGGCCGCCATCNCCGTCGCTTGGCTTCTTCTGGAC
HKR348484 RBb71D12 pGCAP1 NM_005381.2
TGGTAGTGGAGATGTCCGGCCGGTCTAAGCGGGAGTCTCGCGGTTCCACTCGCGGGAAGC
HKR405296 RBdS013D24 pGCAP10 NM_005381.2
GAGTCTCGAGCTCNNNTCNGCCTTCGGGTGTACNTGCTCCGGGATCTTCANCACCCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl