Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05387

HP ID(1) HP05387
Gene ID(2) 55773
Gene Symbol finder TBC1D23
Protein Name TBC1 domain family, member 23
RefSeq NM_018309.2
Length of RefSeq (bp) 3846
Chromosome 3q12.1-q12.2
Reference DDBJ accession
UniGene Hs.477003

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe62A05 pKA1U5 GGTGGACGTCAACAGCAATGGCGGAAGGAGAAGATGTGCCGCCGCTGCCAACGTCGAGCG
RBb20C08 pKA1U5 GAGTTGTTCTCTGGCGGGCAGAGTGGGTGTCCCAAGGATGCTCAGTGGGGGAGCTTTTTG
RBd41B10 pGCAP10 GAGCAATGGCGGAAGGAGAAGATGTGCCGCCGCTGCCAACGTCGAGCGGCGACGGCTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl