DNA Bank Top | 

RIKEN DNA Bank Human Resource - TBC1D23

Gene ID NCBI Gene 55773 |  KEGG hsa:55773
Gene Symbol TBC1D23
Protein Name TBC1 domain family member 23
Synonyms NS4ATP1|PCH11

Link

Ortholog resource in our bank

External database

human TBC1D23

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB15011 pEGFP-C1-human TBC1D23 Expression vector of human TBC1 domain family member 23 (TBC1D23), fused with N-terminal EGFP, CMV promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008203 IRAK020I11 pCMV-SPORT6 BC020955 NM_018309 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064805 ARe62A05 pKA1U5 NM_018309.2  
GGTGGACGTCAACAGCAATGGCGGAAGGAGAAGATGTGCCGCCGCTGCCAACGTCGAGCG
HKR328056 RBb20C08 pKA1U5 NM_018309.2  
GAGTTGTTCTCTGGCGGGCAGAGTGGGTGTCCCAAGGATGCTCAGTGGGGGAGCTTTTTG
HKR376434 RBd41B10 pGCAP10 NM_018309.2  
GAGCAATGGCGGAAGGAGAAGATGTGCCGCCGCTGCCAACGTCGAGCGGCGACGGCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl