Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05383

HP ID(1) HP05383
Gene ID(2) 51093
Gene Symbol finder C1orf66
Protein Name chromosome 1 open reading frame 66
RefSeq NM_015997.3
Length of RefSeq (bp) 2283
Chromosome 1q23.1
Reference DDBJ accession
UniGene Hs.512597

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS045D10 pGCAP10 GACTCCANCATCNGATCCCGGAAAGGCAGCGTCGGAGACTGGACCCAAAACTCTTCCTGT
RBb20B03 pKA1U5 GGGCCCGCCTCGTTGTGAGCTGAGCTCAGCGGCACGCTTTTGTGGCGTCACTGCACTGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl