Prev. | 

RIKEN DNA Bank Human Resource - RRNAD1

Gene ID NCBI Gene 51093 |  KEGG hsa:51093
Gene Symbol RRNAD1
Protein Name ribosomal RNA adenine dimethylase domain containing 1
Synonyms C1orf66|CGI-41|METTL25B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005298 IRAK013E02 pCMV-SPORT6 BC011382 NM_015997

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218082 ARiS045D10 pGCAP10 NM_015997.3  
GACTCCANCATCNGATCCCGGAAAGGCAGCGTCGGAGACTGGACCCAAAACTCTTCCTGT
HKR328027 RBb20B03 pKA1U5 NM_015997.3  
GGGCCCGCCTCGTTGTGAGCTGAGCTCAGCGGCACGCTTTTGTGGCGTCACTGCACTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl