Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05373

HP ID(1) HP05373
Gene ID(2) 26608
Gene Symbol finder TBL2
Protein Name transducin (beta)-like 2
RefSeq NM_012453.2
Length of RefSeq (bp) 3041
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.647044

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe44G04 pKA1U5 GAGTGGTTCCACCAACATGGAGCTCTCGCAGATGTCNTNAGCTCATGGGGCTGTCGGTGT
ARi45D09 pGCAP10 GACTAGCTGAGGTGGCAGTGGTTCCACCAACATGGAGCTCTCGCAGATGTCGGAGCTCAT
RBb19A08 pKA1U5 TGAGGCCGCGCCCCCGCGTGCGTGCGCGGCCCGGCANAGCCGTGCGGGCGCCCGCGTACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl