Prev. | 

RIKEN DNA Bank Human Resource - TBL2

Gene ID NCBI Gene 26608 |  KEGG hsa:26608
Gene Symbol TBL2
Protein Name transducin beta like 2
Synonyms WBSCR13|WS-betaTRP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011245 IRAK028B21 pCMV-SPORT6 BC012938 NM_012453 Partial/var
HGY086897 IRAL017E01 pOTB7 BC006308 NM_012453 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057748 ARe44G04 pKA1U5 NM_012453.2  
GAGTGGTTCCACCAACATGGAGCTCTCGCAGATGTCNTNAGCTCATGGGGCTGTCGGTGT
HKR178081 ARi45D09 pGCAP10 NM_012453.2  
GACTAGCTGAGGTGGCAGTGGTTCCACCAACATGGAGCTCTCGCAGATGTCGGAGCTCAT
HKR327608 RBb19A08 pKA1U5 NM_012453.2  
TGAGGCCGCGCCCCCGCGTGCGTGCGCGGCCCGGCANAGCCGTGCGGGCGCCCGCGTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl