Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05362

HP ID(1) HP05362
Gene ID(2) 55744
Gene Symbol finder C7orf44
Protein Name chromosome 7 open reading frame 44
RefSeq NM_018224.2
Length of RefSeq (bp) 857
Chromosome 7p13
Reference DDBJ accession
UniGene Hs.655165

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi53A11 pGCAP10 GGCNNCNGGCCANGCGGGGCCNGGCACACAGTCTGGGCNGTGTCTGTCAGGANGTATGCA
ARi66B11 pGCAP10 ACACAGTCTGGGCTGTGTCTGTCAGGATGGTGGGCTGAATGCTCGCTCTGTGCTGGGCTG
RBb15G10 pKA1U5 GGGGCATTTACCCGTGCTTTCCCAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGTGG
RBb71D08 pGCAP1 GGCTGGCGCGCAGGACCGCGGGCATTTACCCGTGCTTTCCCAAGCCTGGAAGAACTCGTC
RBd49D04 pGCAP10 GAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGTGGTGCTTCTGTTGCTCACAGGTTG
RBd50B12 pGCAP10 GGCGGGCATTTACCCGTGCTTTCCCAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGT
RBd75H11 pGCAP10 GGTGCTTTCCCAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGTGGTGCTTCTGTTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl