Prev. |  KEGG KO K18173 > 

RIKEN DNA Bank Human Resource - COA1

Gene ID NCBI Gene 55744 |  KEGG hsa:55744
Gene Symbol COA1
Protein Name cytochrome c oxidase assembly factor 1 homolog
Synonyms C7orf44|MITRAC15
Ortholog resources KEGG ortholog (KEGG orthology K18173) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047909 IRAK119M21 pCMV-SPORT6 BC056884 NM_018224 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR181211 ARi53A11 pGCAP10 NM_018224.2  
GGCNNCNGGCCANGCGGGGCCNGGCACACAGTCTGGGCNGTGTCTGTCAGGANGTATGCA
HKR186435 ARi66B11 pGCAP10 NM_018224.2  
ACACAGTCTGGGCTGTGTCTGTCAGGATGGTGGGCTGAATGCTCGCTCTGTGCTGGGCTG
HKR326154 RBb15G10 pKA1U5 NM_018224.2  
GGGGCATTTACCCGTGCTTTCCCAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGTGG
HKR348480 RBb71D08 pGCAP1 NM_018224.2  
GGCTGGCGCGCAGGACCGCGGGCATTTACCCGTGCTTTCCCAAGCCTGGAAGAACTCGTC
HKR379676 RBd49D04 pGCAP10 NM_018224.2  
GAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGTGGTGCTTCTGTTGCTCACAGGTTG
HKR380036 RBd50B12 pGCAP10 NM_018224.2  
GGCGGGCATTTACCCGTGCTTTCCCAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGT
HKR390179 RBd75H11 pGCAP10 NM_018224.2  
GGTGCTTTCCCAAGCCTGGAAGAACTCGTCATGCTCTTTGTAGCGTGGTGCTTCTGTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl