Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05330

HP ID(1) HP05330
Gene ID(2) 93643
Gene Symbol finder TJAP1
Protein Name tight junction associated protein 1 (peripheral)
RefSeq NM_080604.1
Length of RefSeq (bp) 2720
Chromosome 6p21.1
Reference DDBJ accession
UniGene Hs.520145

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb13C01 pKA1U5 GGCCCCGCGGCAAGATGGCGGCCTGAACGCAGCTGGCAGCGGCGGAAAGCTTAGATCAGC
RBd27B07 pGCAP10 GCTGCCCCGCGGCAAGATGGCGGCCTGAACGCAGCTGGCAGCGGCGGAAAGAGCTGTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl