Prev. |  KEGG KO K06105 > 

RIKEN DNA Bank Human Resource - TJAP1

Gene ID NCBI Gene 93643 |  KEGG hsa:93643
Gene Symbol TJAP1
Protein Name tight junction associated protein 1
Synonyms PILT|TJP4
Ortholog resource in our bank

  TJAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055620 IRAK139A20 pCMV-SPORT6 BC064401 NM_080604 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325249 RBb13C01 pKA1U5 NM_080604.1  
GGCCCCGCGGCAAGATGGCGGCCTGAACGCAGCTGGCAGCGGCGGAAAGCTTAGATCAGC
HKR370831 RBd27B07 pGCAP10 NM_080604.1  
GCTGCCCCGCGGCAAGATGGCGGCCTGAACGCAGCTGGCAGCGGCGGAAAGAGCTGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl