Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05326

HP ID(1) HP05326
Gene ID(2) 27072
Gene Symbol finder VPS41
Protein Name vacuolar protein sorting 41 homolog (S. cerevisiae)
RefSeq NM_014396.3
Length of RefSeq (bp) 4894
Chromosome 7p14-p13
Reference DDBJ accession
UniGene Hs.592184

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb12H07 pKA1U5 GGACTCTCCCGTGGCGCCATGGCGGAAGCAGAGGAGCAGGAAACTGGGTCCCTTGAAGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl