Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05322

HP ID(1) HP05322
Gene ID(2) 5090
Gene Symbol finder PBX3
Protein Name pre-B-cell leukemia homeobox 3
RefSeq NM_006195.5
Length of RefSeq (bp) 2911
Chromosome 9q33-q34
Reference DDBJ accession
UniGene Hs.428027

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe89B07 pKA1U5 GGTCAATCCCTCGGCCCAGCGGCCTTCCAGCCCGGTCCGCGGCGGCTGCTGGCTGGGTGC
RBb12F12 pKA1U5 GGCCGCCGCCTCAGCCTTCGCCTCAGCCGCCGCCCGCNTCCCGCCCGCGCGCGGCGGGAT
RBb65E02 pGCAP1 GGGCTGGGTGCGCGGCTCCGGCGGCGGCGGCGGCGACTTCTCCTGCCCTATCCATCGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl