Prev. |  KEGG KO K15610 > 

RIKEN DNA Bank Human Resource - PBX3

Gene ID NCBI Gene 5090 |  KEGG hsa:5090
Gene Symbol PBX3
Protein Name PBX homeobox 3
Synonyms -
Ortholog resource in our bank

  PBX3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011179 IRAK027P19 pCMV-SPORT6 BC016977 NM_006195 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075631 ARe89B07 pKA1U5 NM_006195.5  
GGTCAATCCCTCGGCCCAGCGGCCTTCCAGCCCGGTCCGCGGCGGCTGCTGGCTGGGTGC
HKR324932 RBb12F12 pKA1U5 NM_006195.5  
GGCCGCCGCCTCAGCCTTCGCCTCAGCCGCCGCCCGCNTCCCGCCCGCGCGCGGCGGGAT
HKR346098 RBb65E02 pGCAP1 NM_006195.5  
GGGCTGGGTGCGCGGCTCCGGCGGCGGCGGCGGCGACTTCTCCTGCCCTATCCATCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl