Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05318

HP ID(1) HP05318
Gene ID(2) 51495
Gene Symbol finder PTPLAD1
Protein Name protein tyrosine phosphatase-like A domain containing 1
RefSeq NM_016395.2
Length of RefSeq (bp) 3213
Chromosome 15q22.2
Reference DDBJ accession
UniGene Hs.512973

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe63B10 pKA1U5 GACTGCGCAGGCGCGGCCCGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTC
ARi55H02 pGCAP10 GGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTCAGGAGCGCTAGGGTTTGA
RBb12D08 pKA1U5 GACTGCGCAGGCGCGGCCCGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTC
RBd21A07 pGCAP10
RBd94C07 pGCAP10 GATCCCGGCGCGTCACTGCGCAGGCGCGGCCCGGGAGCGTGGGGTATCTCGAGGTGCCGG
RBdS040K19 pGCAP10 GGGGGTAGGGCCGGGGTCGGGTTGTGGTCGGGCCGGGATTGGGCTCTCCTGGGCCATGGC
RBdS104A22 pGCAP10 GGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTCAGGAGCGCTAGGGTTTGA
RBdS104O03 pGCAP10 GGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTCAGGAGCGCTAGGGTTTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl