Prev. |  KEGG KO K10703 > 

RIKEN DNA Bank Human Resource - HACD3

Gene ID NCBI Gene 51495 |  KEGG hsa:51495
Gene Symbol HACD3
Protein Name 3-hydroxyacyl-CoA dehydratase 3
Synonyms B-IND1|BIND1|HSPC121|PTPLAD1
Ortholog resources KEGG ortholog (KEGG orthology K10703) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047728 IRAK119F08 pCMV-SPORT6 BC058912 NM_016395 Full/var
HGY082497 IRAL006E01 pOTB7 BC000194 NM_016395 Partial/var
HGY095723 IRAL039F03 pOTB7 BC035508 NM_016395 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065234 ARe63B10 pKA1U5 NM_016395.2  
GACTGCGCAGGCGCGGCCCGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTC
HKR182170 ARi55H02 pGCAP10 NM_016395.2  
GGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTCAGGAGCGCTAGGGTTTGA
HKR324880 RBb12D08 pKA1U5 NM_016395.2  
GACTGCGCAGGCGCGGCCCGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTC
HKR368407 RBd21A07 pGCAP10 NM_016395.2  
HKR397655 RBd94C07 pGCAP10 NM_016395.2  
GATCCCGGCGCGTCACTGCGCAGGCGCGGCCCGGGAGCGTGGGGTATCTCGAGGTGCCGG
HKR416259 RBdS040K19 pGCAP10 NM_016395.2  
GGGGGTAGGGCCGGGGTCGGGTTGTGGTCGGGCCGGGATTGGGCTCTCCTGGGCCATGGC
HKR441622 RBdS104A22 pGCAP10 NM_016395.2  
GGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTCAGGAGCGCTAGGGTTTGA
HKR441939 RBdS104O03 pGCAP10 NM_016395.2  
GGGGAGCGTGGGGTATCTCGAGGTGCCGGGTTGCAGGCGCTCAGGAGCGCTAGGGTTTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl