Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05310

HP ID(1) HP05310
Gene ID(2) 6938
Gene Symbol finder TCF12
Protein Name transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)
RefSeq NM_003205.3
Length of RefSeq (bp) 4734
Chromosome 15q21
Reference DDBJ accession
UniGene Hs.511504

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS118F14 pGCAP10 CGGCCGGCCGATGAGCCCGCCCCGGGAGGAAGGGGCGNCNNNGNNCTAANGNNNNNNNNN
RBb11H11 pKA1U5 GGAGTAGATCCATGTGTGAATGCATAGTACTGCAANCACTTACTCCCTTTGCCTGTGTGG
RBb72G09 pGCAP1 AGATCCATGTGTGAATGCATAGTACTGAAGACTTACTCCCTTTGCCTGTGTGGATATATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl