Prev. |  KEGG KO K15603 > 

RIKEN DNA Bank Human Resource - TCF12

Gene ID NCBI Gene 6938 |  KEGG hsa:6938
Gene Symbol TCF12
Protein Name transcription factor 12
Synonyms CRS3|HEB|HTF4|HsT17266|TCF-12|bHLHb20|p64
Ortholog resource in our bank

  TCF12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX043022 IRAK107J06 pCMV-SPORT6 BC050556 NM_207037 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247334 ARiS118F14 pGCAP10 NM_003205.3  
CGGCCGGCCGATGAGCCCGCCCCGGGAGGAAGGGGCGNCNNNGNNCTAANGNNNNNNNNN
HKR324579 RBb11H11 pKA1U5 NM_003205.3  
GGAGTAGATCCATGTGTGAATGCATAGTACTGCAANCACTTACTCCCTTTGCCTGTGTGG
HKR348953 RBb72G09 pGCAP1 NM_003205.3  
AGATCCATGTGTGAATGCATAGTACTGAAGACTTACTCCCTTTGCCTGTGTGGATATATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl