Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05303

HP ID(1) HP05303
Gene ID(2) 5087
Gene Symbol finder PBX1
Protein Name pre-B-cell leukemia homeobox 1
RefSeq NM_002585.1
Length of RefSeq (bp) 1819
Chromosome 1q23
Reference DDBJ accession
UniGene Hs.654412

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb11B09 pKA1U5 GAAACAAAAGCAGGAGGCTGCACGGGGCTGCTGGCCCTTTGNAGAGACACGGAGGAGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl