Prev. |  KEGG KO K09355 > 

RIKEN DNA Bank Human Resource - PBX1

Gene ID NCBI Gene 5087 |  KEGG hsa:5087
Gene Symbol PBX1
Protein Name PBX homeobox 1
Synonyms CAKUHED
Ortholog resources KEGG ortholog (KEGG orthology K09355) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324433 RBb11B09 pKA1U5 NM_002585.1  
GAAACAAAAGCAGGAGGCTGCACGGGGCTGCTGGCCCTTTGNAGAGACACGGAGGAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl