Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05302

HP ID(1) HP05302
Gene ID(2) 84335
Gene Symbol finder AKT1S1
Protein Name AKT1 substrate 1 (proline-rich)
RefSeq NM_032375.3
Length of RefSeq (bp) 2389
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.515542

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe87F10 pKA1U5 ATCCTGATGCTGGCTACGGGCACGGCGCGGATGGCGTCGGGGCGCCCCGAGGAGCTGTGG
ARiS023O14 pGCAP10 GATGCTGGCTACGGGCACGGCGCGGATGGCGTCGGGGCGCCCCGAGGAGCTGTGGGAGGC
ARiS191G08 pGCAP10 GGACGGCGCCGGGCCGGCCATGCTGGCTACGGGCACGGCGCGGATGGCGTCGGGGCGCCC
RBb11B03 pKA1U5 GATAAGAGATCGGTGTTTGCCAAGGCCGTGCCGGATTCTCGAGAGCCAAGGCCTGAGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl