Prev. |  KEGG KO K16184 > 

RIKEN DNA Bank Human Resource - AKT1S1

Gene ID NCBI Gene 84335 |  KEGG hsa:84335
Gene Symbol AKT1S1
Protein Name AKT1 substrate 1
Synonyms Lobe|PRAS40
Ortholog resource in our bank

  AKT1S1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044268 IRAK110L04 pCMV-SPORT6 BC051844 NM_032375 Full/var
HGY081531 IRAL003N19 pOTB7 BC007416 NM_032375
HGY083172 IRAL007P12 pOTB7 BC000031 NM_032375 Partial
HGY091828 IRAL029J12 pOTB7 BC016043 NM_032375 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074930 ARe87F10 pKA1U5 NM_032375.3  
ATCCTGATGCTGGCTACGGGCACGGCGCGGATGGCGTCGGGGCGCCCCGAGGAGCTGTGG
HKR209550 ARiS023O14 pGCAP10 NM_032375.3  
GATGCTGGCTACGGGCACGGCGCGGATGGCGTCGGGGCGCCCCGAGGAGCTGTGGGAGGC
HKR276552 ARiS191G08 pGCAP10 NM_032375.3  
GGACGGCGCCGGGCCGGCCATGCTGGCTACGGGCACGGCGCGGATGGCGTCGGGGCGCCC
HKR324427 RBb11B03 pKA1U5 NM_032375.3  
GATAAGAGATCGGTGTTTGCCAAGGCCGTGCCGGATTCTCGAGAGCCAAGGCCTGAGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl