Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05298

HP ID(1) HP05298
Gene ID(2) 9984
Gene Symbol finder THOC1
Protein Name THO complex 1
RefSeq NM_005131.2
Length of RefSeq (bp) 2133
Chromosome 18p11.32
Reference DDBJ accession
UniGene Hs.712543

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122P09 pGCAP10 GGCAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGC
ARiS161O15 pGCAP10 GACGNNCANCCGAGAAGATGNCTCCGACGCCGCCGCTCTTCAGTTTGCCCGAAGCGCGGA
RBb10H01 pKA1U5 GGCAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGC
RBb28E01 pGCAP1 GAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGCCC
RBb58F10 pGCAP1 GGCAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGC
RBd78F09 pGCAP10 GGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGCCCGAAGCG
RBdS177A11 pGCAP10 TGGAGCGAGGCTGGAGGCGCGGAAGGGCNGCGAGAGGNTCGCGGGTGCNNCGCACAGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl