Prev. |  KEGG KO K12878 > 

RIKEN DNA Bank Human Resource - THOC1

Gene ID NCBI Gene 9984 |  KEGG hsa:9984
Gene Symbol THOC1
Protein Name THO complex 1
Synonyms HPR1|P84|P84N5
Ortholog resource in our bank

  THOC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087628 IRAL019B04 pDNR-LIB BC010381 NM_005131 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249169 ARiS122P09 pGCAP10 NM_005131.2  
GGCAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGC
HKR264751 ARiS161O15 pGCAP10 NM_005131.2  
GACGNNCANCCGAGAAGATGNCTCCGACGCCGCCGCTCTTCAGTTTGCCCGAAGCGCGGA
HKR324169 RBb10H01 pKA1U5 NM_005131.2  
GGCAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGC
HKR331297 RBb28E01 pGCAP1 NM_005131.2  
GAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGCCC
HKR343330 RBb58F10 pGCAP1 NM_005131.2  
GGCAGTGGCGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGC
HKR391329 RBd78F09 pGCAP10 NM_005131.2  
GGGGCACGCGCAGCCGAGAAGATGTCTCCGACGCCGCCGCTCTTCAGTTTGCCCGAAGCG
HKR470811 RBdS177A11 pGCAP10 NM_005131.2  
TGGAGCGAGGCTGGAGGCGCGGAAGGGCNGCGAGAGGNTCGCGGGTGCNNCGCACAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl