Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05293

HP ID(1) HP05293
Gene ID(2) 4724
Gene Symbol finder NDUFS4
Protein Name NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa(NADH-coenzyme Q reductase)
RefSeq NM_002495.2
Length of RefSeq (bp) 676
Chromosome 5q11.1
Reference DDBJ accession
UniGene Hs.528222

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi56F08 pGCAP10 GCCTTTCATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACT
ARiS013F17 pGCAP10 GCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACTGAGGCAGA
ARiS013I18 pGCAP10 GCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACTGAGGCAGA
ARiS096M12 pGCAP10 GGCCNGCACNNNNATGTCGNCGGTCTCNNTGTCANNGNTACTGANGCNNANGTNGNGGCN
ARiS161A20 pGCAP10 GAATCCTGGCGTTTGCCNGCCGNANGANNGNNNCCGTTTCNATGNGGTTGGTNGNGNNGN
RBb10A04 pKA1U5 GCTTTTTTCATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTA
RBd28B04 pGCAP10 GCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTACTGAGGCAGACGTTG
RBd28E04 pGCAP10 GATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTACTGAGGCA
RBd97F12 pGCAP10 GATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTACTGAGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl