Prev. |  KEGG KO K03937 > 

RIKEN DNA Bank Human Resource - NDUFS4

Gene ID NCBI Gene 4724 |  KEGG hsa:4724
Gene Symbol NDUFS4
Protein Name NADH:ubiquinone oxidoreductase subunit S4
Synonyms AQDQ|CI-18|CI-18 kDa|CI-AQDQ
Ortholog resources KEGG ortholog (KEGG orthology K03937) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086691 IRAL016M03 pDNR-LIB BC005270 NM_002495 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013282 W01A033D10 pENTR-TOPO IRAL016M03 BC005270 NM_002495  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182528 ARi56F08 pGCAP10 NM_002495.2  
GCCTTTCATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACT
HKR205337 ARiS013F17 pGCAP10 NM_002495.2  
GCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACTGAGGCAGA
HKR205410 ARiS013I18 pGCAP10 NM_002495.2  
GCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACTGAGGCAGA
HKR238700 ARiS096M12 pGCAP10 NM_002495.2  
GGCCNGCACNNNNATGTCGNCGGTCTCNNTGTCANNGNTACTGANGCNNANGTNGNGGCN
HKR264420 ARiS161A20 pGCAP10 NM_002495.2  
GAATCCTGGCGTTTGCCNGCCGNANGANNGNNNCCGTTTCNATGNGGTTGGTNGNGNNGN
HKR324004 RBb10A04 pKA1U5 NM_002495.2  
GCTTTTTTCATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTA
HKR371228 RBd28B04 pGCAP10 NM_002495.2  
GCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTACTGAGGCAGACGTTG
HKR371300 RBd28E04 pGCAP10 NM_002495.2  
GATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTACTGAGGCA
HKR398932 RBd97F12 pGCAP10 NM_002495.2  
GATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTGTCAATGTCAGTGGTACTGAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl