Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05290

HP ID(1) HP05290
Gene ID(2) 7518
Gene Symbol finder XRCC4
Protein Name X-ray repair complementing defective repair in Chinese hamster cells 4
RefSeq NM_022406.2
Length of RefSeq (bp) 1694
Chromosome 5q13-q14
Reference DDBJ accession
UniGene Hs.567359

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb09G07 pKA1U5 GAGACCAGAGTGATGGAGAGGCGATGAGCAAGGAGCAGATTCTAGGTGTGCTTAGAGGCA
RBb47A06 pGCAP1 GAGGCCTGGCTTAGACCCAGAGNTGATGGAGAGGCGATGAGCAAGGAGCAGATTCTA
RBb70C05 pGCAP1 GAAGCTAGTACAACAATTCGGTGAAGGATGAGGCTGGCTTAGACCAGAGTGATGGAGAGG
RBd09E08 pGCAP10 TCAGAAGAAGATATAACAGATGGGAAGCTAGTACAACAATTCGGTGAAGGATGAGGCTGG
RBd19G09 pGCAP10 GAGAAGAAGATATAACAGATGGGAAGCTAGTACAACAATTCGGTGAAGGATGAGGCTGGC
RBd38A02 pGCAP10 GGGTGAAGGATGAGGCTGGCTTAGACCAGAGTGATGGAGAGGCGATGAGCAAGGAGCAGA
RBd53D11 pGCAP10 GGGTGAAGGATGAGGCTGGCTTAGACCAGAGTGATGGAGAGGCGATGAGCAAGGAGCAGA
RBd61D10 pGCAP10 GAGAAGAAGATATAACAGATGGGAAGCTAGTACAACAATTCGGTGAAGGATGAGGCTGGC
RBd63F01 pGCAP10 GAGACCAGAGTGATGGAGAGGCGATGAGCAAGGAGCAGATTCTAGGTGTGCTTAGAGGCA
RBd67A12 pGCAP10 GGCAGAAGAAGATATAACAGATGGGAAGCTAGTACAACAATTCGGTGAAGGATGAGGCTG
RBd98F06 pGCAP10 GGGAAAAGGCGGGATTTAGATCACGTCCCGCAGGCCGGCGGAAGTAGCTGATACTCTCAT
RBdS013G21 pGCAP10 GAGATTCTAGGTGTGCTTAGAGGCAGCAGGATTTGCTGATGAAGGGGTTATGACTGAGCA
RBdS015C06 pGCAP10 GAGACCAGAGTGATGGAGAGGCGATGAGCAAGGAGCAGATTCTAGGTGTGCTTAGAGGCA
RBdS015L06 pGCAP10 GAGACCAGAGTGATGGAGAGGCGATGAGCAAGGAGCAGATTCTAGGTGTGCTTAGAGGCA
RBdS022L22 pGCAP10 GACAAATGCAGAAGAAGATATAACAGATGGGAAGCTAGTACAACAATTCGGTGAAGGATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl