Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05272

HP ID(1) HP05272
Gene ID(2) 10531
Gene Symbol finder PITRM1
Protein Name pitrilysin metalloproteinase 1
RefSeq NM_014889.2
Length of RefSeq (bp) 3465
Chromosome 10p15.2
Reference DDBJ accession
UniGene Hs.528300

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe83H08 pKA1U5 GGCTCGTCATGCGCAATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGG
RBb08G10 pKA1U5 GGTCATGCGCAATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGGCTGA
RBb11F06 pKA1U5 GGTCATGCGCAATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGGCTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl