Prev. |  KEGG KO K06972 > 

RIKEN DNA Bank Human Resource - PITRM1

Gene ID NCBI Gene 10531 |  KEGG hsa:10531
Gene Symbol PITRM1
Protein Name pitrilysin metallopeptidase 1
Synonyms MP1|PreP
Ortholog resources KEGG ortholog (KEGG orthology K06972) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042546 IRAK106G02 pBluescript BC045577 NM_014889 Partial/var
HGY082590 IRAL006H22 pOTB7 BC001150 NM_014889 Partial/var
HGY087548 IRAL018O12 pOTB7 BC005025 NM_014889 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR073376 ARe83H08 pKA1U5 NM_014889.2  
GGCTCGTCATGCGCAATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGG
HKR323354 RBb08G10 pKA1U5 NM_014889.2  
GGTCATGCGCAATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGGCTGA
HKR324526 RBb11F06 pKA1U5 NM_014889.2  
GGTCATGCGCAATGTGGCGCTGCGGCGGGCGGCAGGGCCTGTGTGTGCTGAGGCGGCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl