Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05269

HP ID(1) HP05269
Gene ID(2) 4744
Gene Symbol finder NEFH
Protein Name neurofilament, heavy polypeptide 200kDa
RefSeq NM_021076.3
Length of RefSeq (bp) 3721
Chromosome 22q12.2
Reference DDBJ accession
UniGene Hs.198760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb08E12 pKA1U5 GGCAGTGCCTCCCGCCCCGTCCCGGCCTCGCGCACCTGCTCAGGCCATGATGAGCTTCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl