Prev. |  KEGG KO K04574 > 

RIKEN DNA Bank Human Resource - NEFH

Gene ID NCBI Gene 4744 |  KEGG hsa:4744
Gene Symbol NEFH
Protein Name neurofilament heavy
Synonyms CMT2CC|NFH
Featured content Amyotrophic lateral sclerosis (ALS) - human
Ortholog resource in our bank

  NEFH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005317 IRAK013E21 pCMV-SPORT6 BC008648 NM_021076 Partial/var
HGX069802 IRAK174I10 pCMV-SPORT6 BC073969 NM_021076 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323308 RBb08E12 pKA1U5 NM_021076.3  
GGCAGTGCCTCCCGCCCCGTCCCGGCCTCGCGCACCTGCTCAGGCCATGATGAGCTTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl