Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05265

HP ID(1) HP05265
Gene ID(2) 65109
Gene Symbol finder UPF3B
Protein Name UPF3 regulator of nonsense transcripts homolog B (yeast)
RefSeq NM_080632.1
Length of RefSeq (bp) 2381
Chromosome Xq25-q26
Reference DDBJ accession
UniGene Hs.103832

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb08A08 pKA1U5 GCAAGCCGCTTCAGCGGGGGACGTAGCCATGAAGGAAGAGAAGGAGCACAGGCCTAAGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl