Prev. |  KEGG KO K14328 > 

RIKEN DNA Bank Human Resource - UPF3B

Gene ID NCBI Gene 65109 |  KEGG hsa:65109
Gene Symbol UPF3B
Protein Name UPF3B regulator of nonsense mediated mRNA decay
Synonyms HUPF3B|MRX62|MRX82|MRXS14|RENT3B|UPF3BP1|UPF3BP2|UPF3BP3|UPF3X|Upf3p-X
Ortholog resources KEGG ortholog (KEGG orthology K14328) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE032230 W01A080J14 pENTR-TOPO flj0016b21 AK093728 NM_023010  
HGE032232 W01A080J16 pENTR-TOPO flj0016b21 AK093728 NM_023010  
HGE032238 W01A080J22 pENTR-TOPO flj0016b21 AK093728 NM_023010  
HGE032240 W01A080J24 pENTR-TOPO flj0016b21 AK093728 NM_023010  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323208 RBb08A08 pKA1U5 NM_080632.1  
GCAAGCCGCTTCAGCGGGGGACGTAGCCATGAAGGAAGAGAAGGAGCACAGGCCTAAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl