Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05253

HP ID(1) HP05253
Gene ID(2) 7392
Gene Symbol finder USF2
Protein Name upstream transcription factor 2, c-fos interacting
RefSeq NM_003367.2
Length of RefSeq (bp) 1732
Chromosome 19q13
Reference DDBJ accession
UniGene Hs.454534

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe41E11 pKA1U5 GCCCGTATCTCCTCCGTCCCCTCCTGCCGCGCGGCGTGAGCGCCGGGCTCGGGGCCCCCC
ARe98D03 pKA1U5 GGCTCGCGCCGCCGCCGCCGCCGCCGCCGCGCGCGCGCAGCTCAAGTAAAGGAGGAAAAA
RBb07C08 pKA1U5

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl