Prev. |  KEGG KO K09106 > 

RIKEN DNA Bank Human Resource - USF2

Gene ID NCBI Gene 7392 |  KEGG hsa:7392
Gene Symbol USF2
Protein Name upstream transcription factor 2, c-fos interacting
Synonyms FIP|bHLHb12
Ortholog resources KEGG ortholog (KEGG orthology K09106) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097895 IRAL044M07 pOTB7 BC049821 NM_003367 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056507 ARe41E11 pKA1U5 NM_003367.2  
GCCCGTATCTCCTCCGTCCCCTCCTGCCGCGCGGCGTGAGCGCCGGGCTCGGGGCCCCCC
HKR079275 ARe98D03 pKA1U5 NM_003367.2  
GGCTCGCGCCGCCGCCGCCGCCGCCGCCGCGCGCGCGCAGCTCAAGTAAAGGAGGAAAAA
HKR322856 RBb07C08 pKA1U5 NM_003367.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl