Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05252

HP ID(1) HP05252
Gene ID(2) 4826
Gene Symbol finder NNAT
Protein Name neuronatin
RefSeq NM_005386.2
Length of RefSeq (bp) 1338
Chromosome 20q11.23
Reference DDBJ accession
UniGene Hs.504703

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb07C06 pKA1U5 AGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACCA
RBb32H07 pGCAP1 TTAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGAC
RBb42F01 pGCAP1 AGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACCA
RBb52E07 pGCAP1 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTTCTCGAC
RBb62D12 pGCAP1 AAATGTGAGTGCGCCCAACAGCGGACTCCGAGTACCAGCGGATCTCGGCAAACCCTCTTT
RBd18C05 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd24E10 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd31C04 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd38E09 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd51C04 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd53E08 pGCAP10 CGGCCGGCCGATGAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGNTCTCGGCAAACCC
RBd58G05 pGCAP10 TGAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGNCNNNNCCTCTTTCTCGAC
RBd58H10 pGCAP10 TGAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGAC
RBd79H09 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd87C11 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBd96A12 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS013G03 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS013G14 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS013I19 pGCAP10 GGCNCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACCACC
RBdS014B19 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS014G14 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS014H17 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS014P08 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS022A12 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS022M06 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS022M09 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS040I09 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS070E05 pGCAP10 GGGGTNCTTNGGGCGCGGCCACCGNNGCTGCGGCAGTGCGCCCAACAGCGGACTCCNAGA
RBdS070N09 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS075J04 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS075K20 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS083C11 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS104H04 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS110B22 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS110J12 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS132D04 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS132J05 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
RBdS154N19 pGCAP10 GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl