Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NNAT

Gene ID (NCBI) 4826
Gene Symbol NNAT
Protein Name neuronatin
Synonyms Peg5
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082477 IRAL006D05 pOTB7 BC001768 NM_005386 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR322854 RBb07C06 pKA1U5 NM_005386.2
AGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACCA
HKR367253 RBd18C05 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR369706 RBd24E10 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR332975 RBb32H07 pGCAP1 NM_005386.2
TTAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGAC
HKR372452 RBd31C04 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR375305 RBd38E09 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR336921 RBb42F01 pGCAP1 NM_005386.2
AGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACCA
HKR340903 RBb52E07 pGCAP1 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTTCTCGAC
HKR380452 RBd51C04 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR381304 RBd53E08 pGCAP10 NM_005386.2
CGGCCGGCCGATGAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGNTCTCGGCAAACCC
HKR383349 RBd58G05 pGCAP10 NM_005386.2
TGAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGNCNNNNCCTCTTTCTCGAC
HKR383378 RBd58H10 pGCAP10 NM_005386.2
TGAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGAC
HKR344884 RBb62D12 pGCAP1 NM_005386.2
AAATGTGAGTGCGCCCAACAGCGGACTCCGAGTACCAGCGGATCTCGGCAAACCCTCTTT
HKR391777 RBd79H09 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR394859 RBd87C11 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR398412 RBd96A12 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR405347 RBdS013G03 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR405358 RBdS013G14 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR405411 RBdS013I19 pGCAP10 NM_005386.2
GGCNCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACCACC
HKR405643 RBdS014B19 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR405758 RBdS014G14 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR405785 RBdS014H17 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR405968 RBdS014P08 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR408812 RBdS022A12 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR409094 RBdS022M06 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR409097 RBdS022M09 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR416201 RBdS040I09 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR428101 RBdS070E05 pGCAP10 NM_005386.2
GGGGTNCTTNGGGCGCGGCCACCGNNGCTGCGGCAGTGCGCCCAACAGCGGACTCCNAGA
HKR428321 RBdS070N09 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR430220 RBdS075J04 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR430260 RBdS075K20 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR433259 RBdS083C11 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR441772 RBdS104H04 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR444046 RBdS110B22 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR444228 RBdS110J12 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR452876 RBdS132D04 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR453021 RBdS132J05 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC
HKR461931 RBdS154N19 pGCAP10 NM_005386.2
GAGTGCGCCCAACAGCGGACTCCGAGACCAGCGGATCTCGGCAAACCCTCTTTCTCGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl